LifeTein provides high-quality Peptide Nucleic Acids (PNAs) for research, molecular diagnostics, PCR clamping, FISH imaging, gene regulation, and biosensor applications...
Peptide Nucleic Acids (PNAs) are synthetic DNA/RNA mimics in which nucleobases are attached to a neutral polyamide backbone rather than a negatively charged sugar-phosphate backbone. This unique structure gives PNAs several important advantages over conventional oligonucleotides, including stronger binding to complementary DNA or RNA, higher mismatch discrimination, and remarkable resistance to nucleases and proteases.
Because of these properties, PNAs are widely used in PCR clamping, PNA-FISH, antisense and antigene research, miRNA inhibition, biosensors, microarrays, and double-stranded DNA invasion. LifeTein offers both catalog and custom PNA products, including sequence-specific PNA probes, fluorescently labeled PNA oligos, peptide-conjugated PNAs, and PNA monomers for synthesis and method development.
Why Choose PNA?
PNA offers stronger hybridization, better mismatch discrimination, and higher stability than DNA oligos in many assay formats.
Custom Modifications
Available unlabeled or modified with fluorophores, quenchers, biotin, click handles, peptide conjugates, and other custom groups.
Applications
Ideal for PCR clamping, FISH, imaging, antisense studies, pathogen detection, telomere detection, and nucleic acid research.
Custom PNA Synthesis and Modifications
LifeTein provides custom PNA oligos in unlabeled or labeled formats. PNA sequences can be synthesized with optional terminal modifications and can also be conjugated to peptides for enhanced uptake, targeting, or functionality. Labels can be introduced at one or both ends depending on the application.
Available modifications include fluorophores such as FAM, FITC, Alexa Fluor dyes, Atto dyes, cyanine dyes (Cy3, Cy5, Cy7), DyLight dyes, QSY9, quenchers such as BHQ and Dabcyl, as well as Biotin, Acridine, Azide, Alkyne (DBCO or pentynoic acid), Maleimide, Myristoyl, Palmitic acid, and peptide conjugation. Please contact us if your required modification is not listed.
PNA Applications
PCR Clamping
PNA clamps selectively suppress amplification of wild-type or undesired templates while allowing preferential amplification of mutant or target sequences.
PNA-FISH and Imaging
Fluorescent PNA probes hybridize rapidly and specifically to DNA or RNA targets with low background, making them valuable for FISH and imaging workflows.
Antisense and miRNA Inhibition
PNA binds complementary RNA strongly and can be used to inhibit miRNAs, modulate target gene expression, and support antisense research.
Biosensors and Microarrays
PNA probes are highly useful in biosensor and microarray platforms because of their stability, affinity, and mismatch discrimination.
Featured PNA Products
| Catalog No. | Product | Description | Price / Availability |
|---|---|---|---|
| LT-PNA013 | Chloroplast rRNA blocker | PNA blocker targeting chloroplast-derived rRNA amplification. | $350, 50 nmol, In Stock |
| PMP01-25 | PMP01-25: {GGCAAGTCTTCTTCGGA}-NH2 | PNA PCR clamp commonly used for plant plastid 16S rRNA blocking. | $350, 50 nmol, In Stock |
| APP01-25 | APP01-25: {GGCTCAACTCTGGACAG}-NH2 | Sequence-specific PNA blocker for nucleic acid amplification control. | $350, 50 nmol, In Stock |
| EcoPNA1169 | EcoPNA1169: Biotin-{CAACACACAGTGTC} | PNA-FISH probe for highly specific detection of E. coli O157:H7. | $350, 50 nmol, In Stock |
| LT8195 | (KFF)3K-PNA: KFFKFFKFFK-CTCATACTCT | Peptide-conjugated PNA for enhanced delivery and functional studies. | $450, 50 nmol, In Stock |
| AntiSense PNA | (RXR)4XB-{O}-{gccatttgac} | Peptide-conjugated antisense PNA for targeted gene silencing research. | $450, 25 nmol, In Stock |
PNA-FISH Probes
PNA-FISH probes combine the strong hybridization properties of PNA with fluorescent or affinity labels for highly specific target detection. Because PNA has a neutral backbone, it hybridizes rapidly and efficiently with low background, even at relatively low probe concentrations.
| Probe | Sequence | Application |
|---|---|---|
| TelC telomere probe | CCCTAACCCTAACCCTAA | C-rich telomere probe for telomere detection in human, mouse, and rat chromosomes. |
| TelG telomere probe | TTAGGGTTAGGGTTAGGG | G-rich telomere probe for detection of telomeric repeat regions. |
| Pan-centromere probe | AAACTAGACAGAAGCATT | Human alpha satellite centromeric DNA detection. |
| CENPB probe | ATTCGTTGGAAACGGGA | Targets the CENP-B binding sequence in centromeric DNA. |
| EcoPNA1169 | CAACACACAGTGTC | PNA-FISH probe targeting E. coli O157:H7 strain TW14359. |
| Cre-lox PNA primer | TATAGCATACATTATACGAAGTTAT | PNA sequence for Cre-lox recombination system research. |
PNA Inhibitors and Blockers
Sequence-specific PNA blockers are useful in PCR clamping, host DNA suppression, miRNA inhibition, and selective nucleic acid amplification workflows.
| Product | Sequence | Application |
|---|---|---|
| Mitochondrial rRNA blocker | GGCAAGTGTTCTTCGGA | Suppresses amplification of mitochondrial rRNA-derived targets. |
| Chloroplast rRNA blocker | GGCTCAACCCTGGACAG | Suppresses chloroplast-derived amplification in plant-associated studies. |
| ITS rRNA blocker | CGAGGGCACGTCTGCCTGG | Blocks internal transcribed spacer (ITS) rRNA targets in selective amplification workflows. |
| PNA oligos against human globin | Multiple sequences | Useful for reducing globin-related interference in selected assays. |
PNA Monomers
| Monomer | Product | Price / Availability |
|---|---|---|
| PNA Monomer A | Fmoc-PNA-A(Bhoc)-OH | |
| PNA Monomer T | Fmoc-PNA-T-OH | |
| PNA Monomer G | Fmoc-PNA-G(Bhoc)-OH | |
| PNA Monomer C | Fmoc-PNA-C(Bhoc)-OH | |
| PNA Monomer U | Fmoc-PNA-U-OH | $250, In Stock |
| PNA Monomer J | Fmoc-PNA-J-OH | $350, In Stock |
Common Fluorophores for PNA Probes
| Probe | Ex (nm) | Em (nm) | MW | Notes |
|---|---|---|---|---|
| Alexa 488 dye | 490 | 525 | 699.7 | |
| FITC or FAM | 495 | 519 | 389 | pH sensitive |
| Cyanine Cy2 | 492 | 510 | ||
| Cyanine Cy3 | 550 | 570 | ||
| Alexa 555 dye | 555 | 580 | 534.5 | |
| Rhodamine B | 570 | 590 | ||
| Abberior Star635 | 635 | 655 | 911 | STED and confocal imaging |
| Cyanine Cy5 | 650 | 670 | ||
| Silicon-Rhodamine (SiR) | 652 | 674 | 472.61 | Multicolor live-cell imaging |
CPP-PNA Examples
Cell-penetrating peptide (CPP)-PNA conjugates are commonly used to enhance cellular uptake of PNA probes and inhibitors for intracellular applications.
| CPP | Sequence |
|---|---|
| Pen | RQIKIWFQNRRMKWKK-PNA |
| Tat | GRKKRRQRRRPPQ-PNA |
| 47Tat57 | GGGGYGRKKRRQRRR-PNA |
| Cationic | KKKK-PNA |
| Lys | K-PNA-KKK |
| Arg | RRRRRRRR-PNA |
| H region | AAVALLPAVLLALLA-PNA |
| PTD-4 | YARAAARQARA-PNA |
| Tp-10 | AGYLLGKINLKALAALAKKIL-PNA |
| SSBP(I) | PKKKRKV-PNA |
| C-myc tag | EQKLISEEDLNA-PNA |
| Tat-modified | RRRQRRKKR-PNA |
Need a Custom PNA?
We offer custom PNA design, synthesis, labeling, peptide conjugation, and sequence optimization for research and assay development.
