|
This Peptide Nucleic Acid (PNA) sequence,
TATAGCATACATTATACGAAGTTAT, is designed based on a
loxP-related recognition sequence used in
Cre recombinase-mediated genetic engineering. The loxP system is one of the most widely used site-specific recombination platforms in molecular biology, transgenic model development, and genome engineering.
The canonical loxP site is a 34-base pair DNA element composed of
two 13-bp inverted repeats flanking an
8-bp asymmetric spacer region:
ATAACTTCGTATA - GCATACAT - TATACGAAGTTAT
In the loxP site, the inverted repeat regions serve as
Cre recombinase recognition elements, while the spacer region determines
orientation and recombination outcome. This PNA sequence corresponds to a
loxP-derived target region and can be used in applications where selective recognition,
hybridization, blocking, or analytical interrogation of loxP-containing constructs is required.
Key Features
- Sequence-specific PNA targeting a loxP-related recombination site
- Useful for research involving Cre-lox conditional systems
- High binding affinity and stability due to neutral PNA backbone
- Strong mismatch discrimination compared with DNA oligonucleotides
- Suitable for hybridization-based detection, blocking, and construct analysis
- Compatible with advanced genome engineering and vector validation workflows
Scientific Background
The Cre-lox system is a site-specific recombination technology originally derived from bacteriophage P1. The enzyme Cre recombinase recognizes the loxP site and catalyzes recombination between loxP sites. Because recombination occurs in a predictable and orientation-dependent manner, the system has become a foundational tool for:
- Conditional gene knockout
- Tissue-specific gene activation or deletion
- Inducible transgene regulation
- Recombination-mediated cassette exchange (RMCE)
- Generation of transgenic and engineered cell lines
When two loxP sites are placed in the same orientation, Cre recombinase can excise the intervening DNA segment. When they are in opposite orientations, the intervening sequence can be inverted. These properties make loxP-containing elements highly valuable in controlled genomic rearrangement strategies.
Why Use a PNA for loxP-Related Applications?
PNA molecules are synthetic nucleic acid analogs with a
neutral pseudopeptide backbone rather than the negatively charged phosphodiester backbone found in DNA or RNA. This structural difference gives PNA probes several important advantages:
- Higher binding affinity to complementary nucleic acid targets
- Greater sequence specificity and single-base mismatch discrimination
- Resistance to nuclease and protease degradation
- Improved performance in stringent hybridization conditions
- Enhanced utility for sequence interrogation in complex genetic constructs
For loxP-related constructs, a PNA probe can provide reliable hybridization-based recognition of engineered
sequence elements in plasmids, viral vectors, genomic inserts, or recombination-ready cassettes.
Mechanism and Research Utility
This PNA is designed to hybridize specifically to a
loxP-derived nucleic acid sequence. Depending on the experimental format, it may be used to:
- Identify or confirm the presence of loxP-related elements in engineered constructs
- Interrogate sequence integrity in recombination-ready vectors
- Support hybridization-based assays in construct validation workflows
- Assist in studying sequence accessibility or binding interactions in loxP-containing regions
- Enable targeted detection in systems involving Cre-dependent gene activation or silencing
Because the loxP sequence contains functionally important recognition and spacer elements, sequence-specific
binding reagents such as PNA can be particularly useful in applications where precise discrimination of
engineered recombination sites is needed.
Applications
- Cre-lox system research
- Conditional gene expression studies
- Conditional knockout and knock-in model development
- Recombination-mediated cassette exchange (RMCE)
- Validation of loxP-containing plasmids and viral vectors
- CRISPR/Cas9 systems incorporating recombinase-controlled sgRNA expression
- Synthetic biology and genome engineering workflows
Sequence Context
The sequence TATAGCATACATTATACGAAGTTAT is described as a
variant of the loxP site and is associated with studies involving
conditional gene regulation and recombinase-based genetic engineering. In the broader loxP framework, sequence arrangement is critical because:
- The inverted repeat regions govern Cre recognition
- The spacer region defines directionality
- Small sequence differences can affect recombination behavior or construct design
As a result, sequence-specific PNA tools targeting loxP-derived regions can be valuable for confirming construct architecture, monitoring engineered loci, or developing analytical assays around recombinase-dependent systems.
Research Relevance
loxP-derived elements are widely used in mammalian cell engineering, the generation of transgenic animal models, gene therapy vector design, and conditional CRISPR systems. This PNA sequence is particularly relevant in workflows where researchers need high-specificity recognition of recombination-associated DNA elements.
In reported applications, loxP-related sequences have been incorporated into
conditional expression cassettes, including those designed for controlled
single guide RNA (sgRNA) expression in CRISPR/Cas9 systems. They are also used in
RMCE platforms to facilitate site-specific exchange of DNA cassettes at defined genomic loci.
A sequence-specific PNA targeting such elements may therefore support vector analysis, assay development, and recombination-related construct characterization in advanced molecular biology workflows.
|