TATAGCATACATTATACGAAGTTAT

Product Name
TATAGCATACATTATACGAAGTTAT
Product Quantity
50 nmol
Catalog Number
LT8276
Category
loxP Site PNA Probe
Sequence
TATAGCATACATTATACGAAGTTAT
Purity
>95%
Related Products
Peptide Nucleic Acid (PNA) Products
PNA Synthesis and Peptide Nucleic Acid Service
Peptide–Oligonucleotide Conjugation
Product Description

This Peptide Nucleic Acid (PNA) sequence, TATAGCATACATTATACGAAGTTAT, is designed as a sequence-specific PNA probe targeting a loxP-derived recognition region used in Cre recombinase-mediated genetic engineering. The Cre-lox system is one of the most widely used site-specific recombination platforms for conditional gene knockout, inducible gene expression, transgenic model development, and recombination-mediated cassette exchange.

The canonical loxP site is a 34-base-pair DNA element composed of two 13-bp inverted repeats flanking an 8-bp asymmetric spacer region:

ATAACTTCGTATA - ATGTATGC - TATACGAAGTTAT

The inverted repeat regions are recognized by Cre recombinase, while the spacer sequence determines loxP orientation and recombination outcome. This PNA sequence corresponds to a loxP-derived region and can be used for high-specificity hybridization, blocking, construct interrogation, or analytical recognition of loxP-containing DNA elements.

Why Use PNA for loxP-Related Applications?

PNA molecules are synthetic nucleic acid analogs in which the sugar-phosphate backbone of DNA or RNA is replaced by a neutral pseudopeptide backbone. This structural difference gives PNA probes several useful properties for molecular biology applications:

  • High-affinity binding to complementary DNA or RNA targets
  • Strong sequence specificity and mismatch discrimination
  • Resistance to nuclease and protease degradation
  • Useful performance in hybridization-based assays
  • Compatibility with probe, blocking, and construct validation workflows

Because PNA is not a natural DNA primer, this product is best described as a loxP PNA probe or loxP-targeting PNA, rather than as a PCR primer. It is especially useful where high-affinity recognition of a defined loxP-related sequence is needed.

Scientific Background: Cre-lox System

The Cre-lox system is derived from bacteriophage P1. Cre recombinase recognizes loxP sites and catalyzes site-specific recombination between them. When two loxP sites are placed in the same orientation, Cre recombinase can excise the intervening DNA segment. When loxP sites are in opposite orientations, the intervening DNA can be inverted.

Because of this predictable behavior, loxP elements are widely incorporated into plasmids, viral vectors, genomic knock-in alleles, conditional knockout models, reporter systems, and inducible CRISPR/Cas9 designs. A sequence-specific PNA probe targeting the loxP region can support analysis of these engineered constructs.

Applications

  • Detection or interrogation of loxP-containing plasmids and vectors
  • Hybridization-based construct validation
  • Cre-lox recombination system research
  • Conditional knockout and knock-in model development
  • Recombination-mediated cassette exchange (RMCE)
  • Sequence-specific blocking or accessibility studies
  • Analytical workflows involving loxP-derived DNA regions
  • Synthetic biology and genome engineering research

Mechanism and Research Utility

This PNA hybridizes to a complementary loxP-related DNA sequence through Watson-Crick base pairing. Because the PNA backbone is neutral, the PNA/DNA duplex can exhibit strong binding stability compared with a DNA/DNA duplex of similar length. This makes PNA useful for applications where sequence-specific binding or discrimination of closely related DNA elements is needed.

The loxP site is frequently engineered into genetic constructs as a functional recombination element. A loxP-targeting PNA may therefore be useful in analytical workflows where researchers need to confirm the presence, accessibility, or sequence integrity of a recombination site.

Recommended Customization Options

LifeTein can prepare this loxP-related PNA in customized formats for specialized workflows, including fluorescent labeling, biotinylation, linker addition, peptide conjugation, or other functional modifications.

  • FITC-, FAM-, Cy3-, or Cy5-labeled PNA for detection assays
  • Biotin-PNA for streptavidin capture or pull-down formats
  • Peptide-PNA conjugates for delivery or localization studies
  • Spacer- or linker-modified PNA for surface immobilization

Related LifeTein Services

Peptide Nucleic Acid (PNA) Product Category
PNA Synthesis Service
Peptide–Oligonucleotide Conjugation Service
Fluorescent Labeling Service

Research Use Only. Not for human or therapeutic use.

Scientific Background

TATAGCATACATTATACGAAGTTAT is a 25-residue synthetic peptide with the sequence Thr-Ala-Thr-Ala-Gly-Cys-Ala-Thr-Ala-Cys-Ala-Thr-Thr-Ala-Thr-Ala-Cys-Gly-Ala-Ala-Gly-Thr-Thr-Ala-Thr. The sequence contains 3 cysteine residues, providing potential thiol/disulfide chemistry when the thiol is available. These sequence-derived properties describe the reagent chemically; no specific receptor, enzyme, pathway, disease association, or biological activity is assigned without product-specific experimental evidence.

Research Applications
  • thiol-selective conjugation or immobilization studies
  • LC-MS/HPLC analytical method development
  • sequence-specific assay controls
Experimental Notes

Sequence-derived chemical properties support reagent selection and experimental planning but do not establish biological function. Solubility, aggregation, adsorption, conjugation efficiency, and assay performance should be validated under the intended experimental conditions.

  • 5 Units in Stock
Ask a Question

$390.00

Add to Cart:

For more information, please visit this product's webpage.