|
The Peptide Nucleic Acids (PNA) sequence TATAGCATACATTATACGAAGTTAT is a variant of the loxP site, a 34-base pair sequence recognized by the Cre recombinase enzyme. The canonical loxP sequence is:
ATAACTTCGTATA - GCATACAT - TATACGAAGTTAT.
This sequence consists of two 13-base pair inverted repeats flanking an 8-base pair spacer region. The inverted repeats are the recognition sites for Cre recombinase, while the spacer region determines the directionality of the loxP site.
Function and Applications:
The loxP-Cre system is widely used in genetic engineering to manipulate DNA sequences in a site-specific manner. When two loxP sites are present in the same orientation on a DNA molecule, Cre recombinase can mediate the excision of the DNA segment between them. If the loxP sites are in opposite orientations, Cre recombinase can invert the intervening DNA segment. This system allows researchers to control gene expression, create conditional knockouts, and study gene function in various organisms.
The specific PNA sequence TATAGCATACATTATACGAAGTTAT has been utilized in studies involving conditional gene expression and recombination-mediated cassette exchange (RMCE). For instance, it has been employed in the design of expression cassettes for conditional expression of single guide RNAs (sgRNAs) in CRISPR/Cas9 systems, where recombinase-mediated activation or inactivation of gene expression is desired. Additionally, this sequence has been incorporated into vectors used for RMCE to facilitate the exchange of genetic material at specific genomic loci.
The PNA sequence TATAGCATACATTATACGAAGTTAT is a variant of the loxP site, serving as a recognition site for Cre recombinase. Its application in genetic engineering enables precise manipulation of DNA sequences, facilitating studies on gene function and the development of genetically modified organisms.
|