Peptide Nucleotide Acid (PNA)


  Advanced Search

Peptide Nucleic Acids (PNAs) are synthetic DNA, or RNA mimics that consist of nucleobases attached to a polyamide backbone. PNAs can bind to both DNA and RNA targets in a sequence-specific manner to form PNA/DNA and PNA/RNA duplex structures. The ability of PNAs to sequence-specifically recognize duplex DNA has attracted considerable interest because of their unparalleled ability to invade double-stranded DNA. Besides, PNA confers remarkable resistance to DNases and proteinases. PNA provides a powerful tool to study the mechanism of transcription and an innovative strategy to regulate target gene expression, antisense, antigene agents, molecular probes, 8-17 DNAzyme, 10-23 DNAzyme and biosensors.

LifeTein provides custom PNA oligos, unlabeled or labeled by fluorescent dyes or other modifications. The PNA oligos can be conjugated to peptides for additional functionality. PNA oligomers can be labeled at 5' and/or 3' end. These labels are available upon request: fluorophores including FAM, FITC, Alexa Fluor dyes, Atto dyes, Cyanine dyes (cy3, cy5, cy7), QSY9, Dylight, quenchers (BHQ, Dabcyl), Acridine, Alkyne (DBCO or Pentynoic acid), Azide, Biotin, Maleimide, Myristol, Palmitic acid, et al. Contact us if your modification is not on the list.

Peptide PNA quencher


PNA Applications

  • Microarrays and biosensors: PNA microarray combined with PCR could detect genetically modified organisms.
  • PCR clamping and artificial restriction enzyme: PNA clamp complementary to wild type sequence hybridizes specifically with wild type and blocks its amplification while allowing amplification of the mutant sequence of the imperfect match.
  • Imaging probes and FISH: The fluorescent dye-conjugated PNA can bind to DNA or RNA quickly, even under low salt.
  • Antisense and antigene drugs: PNA can bind to a complementary sequence of mRNA and change its function. PNA can break up DNA duplexes and form PNA/DNA triplex or double duplexes without denaturing the DNA duplex.
  • miRNA inhibitors: PNA binds complementary RNA more strongly than DNA or RNA does. PNA miRNA inhibitors can be conjugated to cell-penetrating peptides without the need for transfection reagents for cell entry.
  • Double strand DNA invasion and capture: Because of its uncharged polyamide backbone, PNA can hybridize to negatively charged DNA or RNA without electrostatic repulsion.

The PNA length of 10~30 mer is used for most applications because Tm of PNA is higher than that of DNA. A longer PNA with a high purine content (>60%) can reduce water solubility. However, we can add additional lysines, O linker AEEA, E linker, or X linker to increase the water solubility. Please avoid the self-complementary sequences such as inverse repeats, hairpin forming, and palindromic sequences because PNA/PNA interaction is stronger than PNA/DNA interaction.


Featured PNA Products



PMP01-25 Peptide nucleotide acid (PNA) PMP01-25: {GGCAAGTCTTCTTCGGA}-NH2   $499     $299, 125nmol,   In Stock
APP01-25 Peptide nucleotide acid (PNA) APP01-25: {GGCTCAACTCTGGACAG}-NH2   $499     $299, 125nmol,   In Stock
EcoPNA1169 Peptide nucleotide acid (PNA) EcoPNA1169: Biotin - {CAACACACAGTGTC}   $499     $299, 125nmol,   In Stock
LT8195 (KFF)3K-PNA:KFFKFFKFFK-CTCATACTCT $1200, 125nmol,   In Stock
PNA Monomer A Fmoc-PNA-A(Bhoc)-OH   $250     $149,  In Stock
PNA Monomer T Fmoc-PNA-T-OH   $250     $149,  In Stock
PNA Monomer G Fmoc-PNA-G(Bhoc)-OH   $250     $149,  In Stock
PNA Monomer C Fmoc-PNA-C(Bhoc)-OH   $250     $149,  In Stock
PNA Monomer U Fmoc-PNA-U-OH $250, In Stock
Peptide-Conjugated Antisense PNA for Targeted Gene Silencing(RXR)4XB-{O}-{gccatttgac}$950, In Stock

PNA FISH Probe

  • PNA has an electrically neutral backbone. This key feature of high specificity enables rapid hybridization with just a small amount of PNA probes without a significant background signal. So, PNA is very efficient and useful when applied to FISH (fluorescent in situ hybridization) at low concentrations.
  • The PNA modifications of Biotin, FAM, Cy3, Cy5, Alexa488, Alexa647, and FITC are available.
  • TelC telomere probe (CCCTAACCCTAACCCTAA): C-rich probe (repeats of CCCTAA); TelC is a C-rich telomere probe for a leading strand (repeats of TAACCC). It is used to detect human, mouse, and rat chromosomes. TelC telomere probe: (CCCTAACCCTAACCCTAA), Reverse Complementary Sequence (5' to 3') TTAGGGTTAGGGTTAGGG
  • TelG telomere probe (TTAGGGTTAGGGTTAGGG): G-rich probe (repeats of TTAGGG); TelG is a G-rich telomere probe for lagging strands (repeats of TTAGGG). TelG telomere probe (TTAGGGTTAGGGTTAGGG), Reverse Complementary Sequence (5' to 3') CCCTAACCCTAACCCTAA
  • Pan-centromere probe (AAACTAGACAGAAGCATT): Cent probe is specific for human alpha satellite centromere and does not react to the mouse. The sequence of the probe is AAACTAGACAGAAGCATT. Reverse Complementary Sequence (5' to 3') is AATGCTTCTGTCTAGTTT.
  • CENPB probe (ATTCGTTGGAAACGGGA): CENPB probe is a binding site for centromere protein B (CENP-B). The probe sequence is ATTCGTTGGAAACGGGA. Reverse Complementary Sequence (5' to 3') is TCCCGTTTCCAACGAAT.
  • CAG repeat probes: (CAG)5-Cy3 and (CAG)5-Cy5
  • PNA primer for the cre-lox recombination system: TATAGCATACATTATACGAAGTTAT
  • EcoPNA1169: Biotin - CAACACACAGTGTC. This Nucleic Acid Mimics (NAMs) sequence 5'-CAA CAC ACA GTG TC-3' hybridizes between positions 1169 and 1183 of E. coli O157:H7 strain TW14359 (CP_001368).

PNA Inhibitors


Probe Ex (nm) Em (nm) MW Notes
Alexa 488 dye 490 525 699.7
FITC or FAM 495 519 389 pH sensitive
Cyanine Cy2 492 510
Cyanine Cy3 550 570
Alexa 555 dye 555 580 534.5
Rhodamine B 570 590
Abberior Star635 635 655 911 STED and Confocal Imaging
Cyanine Cy5 650 670
Silicon-Rhodamine (SiR) 652 674 472.61 Multicolour Live Cell Imaging

CPP-PNA Examples

CPP

Sequence

Pen

RQIKIWFQNRRMKWKK-PNA

Tat

GRKKRRQRRRPPQ-PNA

47Tat57

GGGGYGRKKRRQRRR-PNA

Cationic

KKKK-PNA

Lys

K-PNA-KKK

Arg

RRRRRRRR-PNA

H region

AAVALLPAVLLALLA-PNA

PTD-4

YARAAARQARA-PNA

Tp-10

AGYLLGKINLKALAALAKKIL-PNA

SSBP(I)

PKKKRKV-PNA

C-myc tag

EQKLISEEDLNA-PNA

Tat-modified

RRRQRRKKR-PNA

Displaying 11 to 19 (of 19 Products)
Price Product Name
$1,200.00
... more info

KFFKFFKFFK-CTCATACTCT

Product Name (KFF)3K-PNA:KFFKFFKFFK-CTCATACTCTProduct Quantity 125nmolCatalog Number LT8195 Purity >95% Sequence KFFKFFKFFK-{CTCATACTCT}-NH2 Description The acpP-targeting antisense PNA CTCATACTCT, particularly when linked to the cell...
$299.00
... more info

Mitochondrial rRNA blocker

Product Name Mitochondrial rRNA blocker Product Description The Mitochondrial rRNA blocker with the sequence GGCAAGTGTTCTTCGGA is designed to target mitochondrial ribosomal RNA (rRNA), specifically blocking the function of 12S or 16S...
$299.00
... more info

Pan-centromere PNA probe

Product Name Pan-centromere PNA probe Product Description The Pan-centromere PNA probe (sequence: AAACTAGACAGAAGCATT) is designed to bind to the centromeric regions of human chromosomes. The centromere is a crucial part of chromosomes,...
$598.80 $299.00Save: 50% off
... more info

PMP01-25

Product NamePMP01-25Product Quantity 125nmolCatalog Number LT-PNA001 Purity >95% Sequence {GGCAAGTCTTCTTCGGA}-NH2 Description PNA probes have no direct interaction with DNA polymerase. However, PNAs can terminate the elongation of...
$299.00
... more info

PNA oligos against human globin

Product Name PNA oligos against human globin Product Description The PNA oligo Lys-TAACGGTATTTGGAG-Lys is a synthetic peptide nucleic acid (PNA) designed to target human globin mRNA . It binds specifically to globin mRNA sequences, thus blocking...
$950.00
... more info

RXRRXRRXRRXRXB-PNA

Product NamePeptide-Conjugated Antisense PNA (RXR)₄XB-{O}-{gccatttgac} for Targeted Gene Silencing Product Quantity 1 mg Purity >95% Catalog Number LT-PNA017 Solubility Solid powder Product Description Peptide-Conjugated Antisense PNA...
$450.00
... more info

TATAGCATACATTATACGAAGTTAT

Catalog Number: LT8276 Category: loxP site PNA Sequence: TATAGCATACATTATACGAAGTTAT Quantity: 100 umol Purity: >95% Description: The Peptide Nucleic Acids (PNA) sequence TATAGCATACATTATACGAAGTTAT is a variant of the loxP site, a 34-base...
$299.00
... more info

TelC telomere PNA probe

Product Name TelC telomere PNA probe Product Description The PNA sequence TelC, consisting of the repeat motif (CCCTAACCCTAACCCTAA), is a peptide nucleic acid probe that specifically binds to the C-rich telomere sequences of the leading strand of...
$299.00
... more info

TelG telomere PNA probe

Product Name TelG telomere PNA probe Product Description The PNA sequence TelG telomere probe (TTAGGGTTAGGGTTAGGG) is a G-rich probe specifically designed to target the G-rich strand of telomeric DNA, primarily associated with the lagging strand...
Displaying 11 to 19 (of 19 Products)