All Products
Displaying 1 to 10 (of 7681 Products)
| Price | Product Name |
|---|---|
$350.00 ... more info |
Catalog Number: LT8284 Category: Peptide Sequence:YGRKKRRQRRRYKEGYNVYG Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence YGRKKRRQRRRYKEGYNVYG is a fusion construct combining the HIV-1 TAT protein transduction... |
$350.00 ... more info |
Product NameFAM HIV-1 tat Protein (47-57)Product Quantity1 mg Product Description This is the most characterized fragment of the HIV transactivator protein (TAT) YGRKKRRQRRR. The TAT peptide is rich in positively charged amino acids, notably... |
$250.00 ... more info |
Catalog Number: LT8282 Category: HA tag Peptide C-YPYDVPDYA Sequence:C-YPYDVPDYA; Related product: Anti HA Monoclonal Antibody Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence YPYDVPDYA is widely recognized... |
$250.00 ... more info |
Catalog Number: LT8283 Category: c-Myc tag Peptide EQKLISEEDL Sequence:EQKLISEEDL; Related product: Anti cMyc Monoclonal Antibody Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence EQKLISEEDL corresponds to the... |
$250.00 ... more info |
Catalog Number: LT8281 Category: AviTag Peptide Sequence: GLNDIFEAQKIEWHE Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence GLNDIFEAQKIEWHE is known as the AviTag , a 15-amino-acid peptide widely used in... |
$500.00 ... more info |
Catalog Number: LT8280 Category: Peptide Sequence: HSQGTFTSDYSKYLDSRRAQDFVQWLMNT Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence HSQGTFTSDYSKYLDSRRAQDFVQWLMNT corresponds to human glucagon , a... |
$280.00 ... more info |
Catalog Number: LT8279 Category: Peptide Sequence: EAAGIGILTV Modifications: Quantity: 1-4mg Purity: >95% Description: The peptide sequence EAAGIGILTV is a decamer derived from the Melan-A/MART-1 protein, a melanocyte differentiation... |
$280.00 ... more info |
Catalog Number: LT8278 Category: Peptide Sequence: CEAITKTNL Modifications: Quantity: 1-4mg Purity: >95% Description: The peptide sequence CEAITKTNL is a 9-amino-acid fragment that has been identified as a potential T-cell epitope... |
$250.00 ... more info |
Catalog Number: LT8277 Category: self-peptide Sequence: GNYTCEVTELTREGETIIELK Quantity: 4mg Purity: >95% Description: The peptide sequence GNYTCEVTELTREGETIIELK is a synthetic "self-peptide" derived from the extracellular domain of human... |
$450.00 ... more info |
Catalog Number: LT8276 Category: loxP site PNA Sequence: TATAGCATACATTATACGAAGTTAT Quantity: 100 umol Purity: >95% Description: The Peptide Nucleic Acids (PNA) sequence TATAGCATACATTATACGAAGTTAT is a variant of the loxP site, a 34-base... |
Displaying 1 to 10 (of 7681 Products)
