My Account Information
Displaying 31 to 40 (of 7701 Products)
| Price | Product Name |
|---|---|
$280.00 ... more info |
Catalog Number: LT8278 Category: Peptide Sequence: CEAITKTNL Modifications: Quantity: 1-4mg Purity: >95% Description: The peptide sequence CEAITKTNL is a 9-amino-acid fragment that has been identified as a potential T-cell epitope... |
$450.00 ... more info |
FITC-Ahx-GNYTCEVTELTREGETIIELK Catalog Number: LT8277 Category: self-peptide Sequence: FITC-Ahx-GNYTCEVTELTREGETIIELK (FITC labeling at the N-terminus) , Click here to order CD47 GNYTCEVTELSREGKTVIELK plain peptide. Quantity: 4mg Purity: >95% Description: The peptide... |
$450.00 ... more info |
Catalog Number: LT8276 Category: loxP site PNA Sequence: TATAGCATACATTATACGAAGTTAT Quantity: 100 umol Purity: >95% Description: The Peptide Nucleic Acids (PNA) sequence TATAGCATACATTATACGAAGTTAT is a variant of the loxP site, a 34-base... |
$250.00 ... more info |
Catalog Number: LT8275 Category: ARA70 Coactivator Peptide Sequence: YRGAFQNLFQSV Quantity: 4mg Purity: >95% Description: The peptide sequence YRGAFQNLFQSV corresponds to a segment derived from the N-terminal domain (NTD) of the human... |
$250.00 ... more info |
Catalog Number: LT8274 Category: ARA70 Coactivator Peptide Sequence: VLPRAMQT Quantity: 4mg Purity: >95% Description: The peptide sequence VLPRAMQT corresponds to an 8-amino-acid fragment derived from the chicken interleukin-10 (IL-10)... |
$250.00 ... more info |
Catalog Number: LT8273 Category: ARA70 Coactivator Peptide Sequence: CKENALLRYLLDKDD Quantity: 4mg Purity: >95% Description: The peptide sequence CKENALLRYLLDKDD corresponds to a segment derived from the human steroid receptor... |
$250.00 ... more info |
Catalog Number: LT8272 Category: ARA70 Coactivator Peptide Sequence: C-SRETSEKFKLLFQSYNVND Quantity: 4mg Purity: >95% Description: The peptide sequence SRETSEKFKLLFQSYNVND corresponds to the ARA70 coactivator peptide, which is utilized... |
$250.00 ... more info |
Catalog Number: LT8271 Category: TAT-NR2Bct Sequence: YGRKKRRQRRRKLSSIESDV Quantity: 4mg Purity: >95% Description: Tat-NR2B9c, also known as Tat-NR2Bct, NA-1, or nerinetide, is a 20-amino-acid peptide designed to inhibit postsynaptic... |
$250.00 ... more info |
Catalog Number: LT8269 Category: HIV-1 Tat (48-60),Cys C-term Sequence: GRKKRRQRRRPPQ-Cys Quantity: 4mg Purity: >95% Description: The peptide sequence GRKKRRQRRRPPQ-Cys is a unique and potent cell-penetrating peptide that has gained... |
$250.00 ... more info |
Catalog Number: LT8269 Category: HIV-1 Tat (48-60),Cys C-term Sequence: GRKKRRQRRRPPQ-Cys Quantity: 4mg Purity: >95% Description: The peptide sequence GRKKRRQRRRPPQ-Cys is a unique and potent cell-penetrating peptide that has gained... |
Displaying 31 to 40 (of 7701 Products)
