My Account Information
Displaying 41 to 50 (of 7702 Products)
| Price | Product Name |
|---|---|
$450.00 ... more info |
FITC-Ahx-GNYTCEVTELTREGETIIELK Catalog Number: LT8277 Category: self-peptide Sequence: FITC-Ahx-GNYTCEVTELTREGETIIELK (FITC labeling at the N-terminus), CD47-derived peptide . Quantity: 4mg Purity: >95% Related Products CD47 peptide FITC-Ahx-CD47 peptide Self CD47... |
$390.00 ... more info |
Catalog Number: LT8276 Category: loxP Site PNA Probe Sequence: TATAGCATACATTATACGAAGTTAT Quantity: 50 nmol Purity: >95% Related Products Peptide Nucleic Acid (PNA) Products PNA Synthesis and Peptide Nucleic Acid Service... |
$250.00 ... more info |
Catalog Number: LT8275 Category: ARA70 Coactivator Peptide Sequence: YRGAFQNLFQSV Quantity: 4mg Purity: >95% Description: The peptide sequence YRGAFQNLFQSV corresponds to a segment derived from the N-terminal domain (NTD) of the human... |
$250.00 ... more info |
Catalog Number: LT8274 Category: ARA70 Coactivator Peptide Sequence: VLPRAMQT Quantity: 4mg Purity: >95% Description: The peptide sequence VLPRAMQT corresponds to an 8-amino-acid fragment derived from the chicken interleukin-10 (IL-10)... |
$250.00 ... more info |
Catalog Number: LT8273 Category: ARA70 Coactivator Peptide Sequence: CKENALLRYLLDKDD Quantity: 4mg Purity: >95% Description: The peptide sequence CKENALLRYLLDKDD corresponds to a segment derived from the human steroid receptor... |
$250.00 ... more info |
Catalog Number: LT8272 Category: ARA70 Coactivator Peptide Sequence: C-SRETSEKFKLLFQSYNVND Quantity: 4mg Purity: >95% Description: The peptide sequence SRETSEKFKLLFQSYNVND corresponds to the ARA70 coactivator peptide, which is utilized... |
$250.00 ... more info |
Catalog Number: LT8271 Category: TAT-NR2Bct Sequence: YGRKKRRQRRRKLSSIESDV Quantity: 4mg Purity: >95% Description: Tat-NR2B9c, also known as Tat-NR2Bct, NA-1, or nerinetide, is a 20-amino-acid peptide designed to inhibit postsynaptic... |
$250.00 ... more info |
Catalog Number: LT8269 Category: HIV-1 Tat (48-60),Cys C-term Sequence: GRKKRRQRRRPPQ-Cys Quantity: 4mg Purity: >95% Description: The peptide sequence GRKKRRQRRRPPQ-Cys is a unique and potent cell-penetrating peptide that has gained... |
$250.00 ... more info |
Catalog Number: LT8269 Category: HIV-1 Tat (48-60),Cys C-term Sequence: GRKKRRQRRRPPQ-Cys Quantity: 4mg Purity: >95% Description: The peptide sequence GRKKRRQRRRPPQ-Cys is a unique and potent cell-penetrating peptide that has gained... |
$250.00 ... more info |
Catalog Number: LT8268 Category: HIV-1 Tat (48-60),Cys N-term Sequence: Cys-GRKKRRQRRRPPQ Quantity: 4mg Purity: >95% Description: The peptide Cys-GRKKRRQRRRPPQ is a synthetic peptide that is derived from the protein sequences of various... |
Displaying 41 to 50 (of 7702 Products)
