My Account Information
Displaying 7151 to 7160 (of 7704 Products)
| Price | Product Name |
|---|---|
$389.00 ... more info |
Product NameTAL1 Rabbit pAb Catalog NumberLTA23371 Quantity100ul Price $ 389 In stock DescriptionTAL1 Rabbit pAb is produced by immunizing Rabbit with Recombinant fusion protein containing a sequence corresponding to amino acids 242-331 of... |
$389.00 ... more info |
Product NameTALDO1 Rabbit pAb Catalog NumberLTA23925 Quantity100ul Price $ 389 In stock DescriptionTALDO1 Rabbit pAb is produced by immunizing Rabbit with Recombinant fusion protein containing a sequence corresponding to amino acids 1-337... |
$389.00 ... more info |
Product NameTARS2 Rabbit pAb Catalog NumberLTA23316 Quantity100ul Price $ 389 In stock DescriptionTARS2 Rabbit pAb is produced by immunizing Rabbit with Recombinant fusion protein containing a sequence corresponding to amino acids 100-400... |
$389.00 ... more info |
Product NameTAS1R1 Rabbit pAb Catalog NumberLTA21134 Quantity100ul Price $ 389 In stock DescriptionTAS1R1 Rabbit pAb is produced by immunizing Rabbit with Recombinant fusion protein containing a sequence corresponding to amino acids 330-567... |
$389.00 ... more info |
Product NameTAS1R3 Rabbit pAb Catalog NumberLTA21135 Quantity100ul Price $ 389 In stock DescriptionTAS1R3 Rabbit pAb is produced by immunizing Rabbit with Recombinant fusion protein containing a sequence corresponding to amino acids 400-570... |
$397.44 ... more info |
Product NameTATProduct Quantity5mg Product Description Tat is the nuclear transcriptional activator of viral gene expression in HIV proliferation. it binds to a regulatory element in the HIV-1 long terminal repeat. By recruiting P-TEFb to TAR, TaT... |
$427.68 ... more info |
Product NameTAT 2-4Product Quantity5mg Product Description The HIV Tat-derived peptide (24 aa) is a small basic peptide that can deliver a large variety of cargoes, from small particles to proteins, peptides and nucleic acids into the cell. ... |
$250.00 ... more info |
Catalog Number: LT8269 Category: HIV-1 Tat (48-60),Cys C-term Sequence: GRKKRRQRRRPPQ-Cys Quantity: 4mg Purity: >95% Description: The peptide sequence GRKKRRQRRRPPQ-Cys is a unique and potent cell-penetrating peptide that has gained... |
$250.00 ... more info |
Catalog Number: LT8271 Category: TAT-NR2Bct Sequence: YGRKKRRQRRRKLSSIESDV Quantity: 4mg Purity: >95% Description: Tat-NR2B9c, also known as Tat-NR2Bct, NA-1, or nerinetide, is a 20-amino-acid peptide designed to inhibit postsynaptic... |
$390.00 ... more info |
Catalog Number: LT8276 Category: loxP site PNA Sequence: TATAGCATACATTATACGAAGTTAT Quantity: 50 nmol Purity: >95% Description: This Peptide Nucleic Acid (PNA) sequence, TATAGCATACATTATACGAAGTTAT , is designed based on a loxP-related... |
Displaying 7151 to 7160 (of 7704 Products)
