My Account Information
Displaying 21 to 30 (of 7696 Products)
| Price | Product Name |
|---|---|
$250.00 ... more info |
Catalog Number: LT8281 Category: AviTag Peptide Sequence: GLNDIFEAQKIEWHE Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence GLNDIFEAQKIEWHE is known as the AviTag , a 15-amino-acid peptide widely used in... |
$500.00 ... more info |
Catalog Number: LT8280 Category: Peptide Sequence: HSQGTFTSDYSKYLDSRRAQDFVQWLMNT Modifications: Quantity: 4mg Purity: >95% Description: The peptide sequence HSQGTFTSDYSKYLDSRRAQDFVQWLMNT corresponds to human glucagon , a... |
$280.00 ... more info |
Catalog Number: LT8279 Category: Peptide Sequence: EAAGIGILTV Modifications: Quantity: 1-4mg Purity: >95% Description: The peptide sequence EAAGIGILTV is a decamer derived from the Melan-A/MART-1 protein, a melanocyte differentiation... |
$280.00 ... more info |
Catalog Number: LT8278 Category: Peptide Sequence: CEAITKTNL Modifications: Quantity: 1-4mg Purity: >95% Description: The peptide sequence CEAITKTNL is a 9-amino-acid fragment that has been identified as a potential T-cell epitope... |
$250.00 ... more info |
Catalog Number: LT8277 Category: self-peptide Sequence: GNYTCEVTELTREGETIIELK Quantity: 4mg Purity: >95% Description: The peptide sequence GNYTCEVTELTREGETIIELK is a synthetic "self-peptide" derived from the extracellular domain of human... |
$450.00 ... more info |
Catalog Number: LT8276 Category: loxP site PNA Sequence: TATAGCATACATTATACGAAGTTAT Quantity: 100 umol Purity: >95% Description: The Peptide Nucleic Acids (PNA) sequence TATAGCATACATTATACGAAGTTAT is a variant of the loxP site, a 34-base... |
$250.00 ... more info |
Catalog Number: LT8275 Category: ARA70 Coactivator Peptide Sequence: YRGAFQNLFQSV Quantity: 4mg Purity: >95% Description: The peptide sequence YRGAFQNLFQSV corresponds to a segment derived from the N-terminal domain (NTD) of the human... |
$250.00 ... more info |
Catalog Number: LT8274 Category: ARA70 Coactivator Peptide Sequence: VLPRAMQT Quantity: 4mg Purity: >95% Description: The peptide sequence VLPRAMQT corresponds to an 8-amino-acid fragment derived from the chicken interleukin-10 (IL-10)... |
$250.00 ... more info |
Catalog Number: LT8273 Category: ARA70 Coactivator Peptide Sequence: CKENALLRYLLDKDD Quantity: 4mg Purity: >95% Description: The peptide sequence CKENALLRYLLDKDD corresponds to a segment derived from the human steroid receptor... |
$250.00 ... more info |
Catalog Number: LT8272 Category: ARA70 Coactivator Peptide Sequence: C-SRETSEKFKLLFQSYNVND Quantity: 4mg Purity: >95% Description: The peptide sequence SRETSEKFKLLFQSYNVND corresponds to the ARA70 coactivator peptide, which is utilized... |
Displaying 21 to 30 (of 7696 Products)