Peptide Nucleotide Acid (PNA)


  Advanced Search

Peptide Nucleic Acids (PNAs) are synthetic DNA, or RNA mimics that consist of nucleobases attached to a polyamide backbone. PNAs can bind to both DNA and RNA targets in a sequence-specific manner to form PNA/DNA and PNA/RNA duplex structures. The ability of PNAs to sequence-specifically recognize duplex DNA has attracted considerable interest because of their unparalleled ability to invade double-stranded DNA. Besides, PNA confers remarkable resistance to DNases and proteinases. PNA provides a powerful tool to study the mechanism of transcription and an innovative strategy to regulate target gene expression, antisense, antigene agents, molecular probes, and biosensors.

LifeTein provides custom PNA oligos, unlabeled or labeled by fluorescent dyes or other modifications. The PNA oligos can be conjugated to peptides for additional functionality. PNA oligomers can be labeled at 5' and/or 3' end. These labels are available upon request: fluorophores including FAM, FITC, Alexa Fluor dyes, Atto dyes, Cyanine dyes (cy3, cy5, cy7), QSY9, Dylight, quenchers (BHQ, Dabcyl), Acridine, Alkyne (DBCO or Pentynoic acid), Azide, Biotin, Maleimide, Myristol, Palmitic acid, et al. Contact us if your modification is not on the list.

Peptide PNA quencher


PNA Applications

  • Microarrays and biosensors: PNA microarray combined with PCR could detect genetically modified organisms.
  • PCR clamping and artificial restriction enzyme: PNA clamp complementary to wild type sequence hybridizes specifically with wild type and blocks its amplification while allowing amplification of the mutant sequence of the imperfect match.
  • Imaging probes and FISH: The fluorescent dye-conjugated PNA can bind to DNA or RNA quickly, even under low salt.
  • Antisense and antigene drugs: PNA can bind to a complementary sequence of mRNA and change its function. PNA can break up DNA duplexes and form PNA/DNA triplex or double duplexes without denaturing the DNA duplex.
  • miRNA inhibitors: PNA binds complementary RNA more strongly than DNA or RNA does. PNA miRNA inhibitors can be conjugated to cell-penetrating peptides without the need for transfection reagents for cell entry.
  • Double strand DNA invasion and capture: Because of its uncharged polyamide backbone, PNA can hybridize to negatively charged DNA or RNA without electrostatic repulsion.

The PNA length of 10~30 mer is used for most applications because Tm of PNA is higher than that of DNA. A longer PNA with a high purine content (>60%) can reduce water solubility. However, we can add additional lysines, O linker AEEA, E linker, or X linker to increase the water solubility. Please avoid the self-complementary sequences such as inverse repeats, hairpin forming, and palindromic sequences because PNA/PNA interaction is stronger than PNA/DNA interaction.


Featured PNA Products

               
                       
PMP01-25Peptide nucleotide acid (PNA) PMP01-25: {GGCAAGTCTTCTTCGGA}-NH2  $499     $299, 125nmol,   In Stock
APP01-25Peptide nucleotide acid (PNA) APP01-25: {GGCTCAACTCTGGACAG}-NH2  $499     $299, 125nmol,   In Stock

PNA FISH Probe

  • PNA has an electrically neutral backbone. This key feature of high specificity enables rapid hybridization with just a small amount of PNA probe without significant background signal. So PNA is very efficient and useful in applying to FISH (fluorescent in situ hybridization) at low concentrations.
  • C-rich probe (repeats of CCCTAA): TelC is a C-rich telomere probe for a leading strand (repeats of TAACCC).It is used to detect human, mouse, rat chromosomes.
  • G-rich probe (repeats of TTAGGG): TelG is a G-rich telomere probe for lagging strand (repeats of TTAGGG).
  • Pan-centromere probe: Cent probe is specific for human alpha satellite centromere and does not react to the mouse. The sequence of the probe is AAACTAGACAGAAGCAT.
  • CENPB probe: CENPB probe is a binding site for centromere protein B (CENP-B). The probe sequence is ATTCGTTGGAAACGGGA.
  • CAG repeat probes: (CAG)5-Cy3 and (CAG)5-Cy5
  • PNA primer for the cre-lox recombination system: TATAGCATACATTATACGAAGTTAT

PNA Inhibitors

  • PNA specifically binds to the miRNAs that are paired with each other and inhibit the regulation of miRNA itself.
  • Mitochondria rRNA blocker: GGCAAGTGTTCTTCGGA
  • Chloroplast rRNA blocker: GGCTCAACCCTGGACAG
  • Internal Transcribed Spacers (ITS) rRNA blocker: CGAGGGCACGTCTGCCTGG
  • PNA oligos against human globin: Lys-TAACGGTATTTGGAG-Lys; Lys-GTAGTTGGACTTAGG-Lys; Lys-ATCCAGATGCTCAAG-Lys; Lys-GCCCTTCATAATATC-Lys

Probe Ex (nm) Em (nm) MW Notes
Alexa 488 dye 490 525 699.7
FITC or FAM 495 519 389 pH sensitive
Cyanine Cy2 492 510
Cyanine Cy3 550 570
Alexa 555 dye 555 580 534.5
Rhodamine B 570 590
Abberior Star635 635 655 911 STED and Confocal Imaging
Cyanine Cy5 650 670
Silicon-Rhodamine (SiR) 652 674 472.61 Multicolour Live Cell Imaging
Displaying 1 to 2 (of 2 Products)
Price Product Name+
$598.80 $299.00Save: 50% off... more info
APP01-25
Product NameAPP01-25Product Quantity 125nmolCatalog Number LT-PNA002 Purity >95% Sequence {GGCTCAACTCTGGACAG}-NH2 Description PNA probes have no direct interaction with DNA polymerase. However, PNAs can terminate the elongation of...
$598.80 $299.00Save: 50% off... more info
PMP01-25
Product NamePMP01-25Product Quantity 125nmolCatalog Number LT-PNA001 Purity >95% Sequence {GGCAAGTCTTCTTCGGA}-NH2 Description PNA probes have no direct interaction with DNA polymerase. However, PNAs can terminate the elongation of...
Displaying 1 to 2 (of 2 Products)
LifeTein LifeTein provides custom peptide synthesis service, recombinant proteins, peptides, cytokines, custom antibody service and custom protein service. LifeTein is the world leader in fast peptide synthesis service with lab facility located in New Jersey USA. LifeTein Peptide 100 Randolph Road, Suite 2D, Somerset USA New Jersey 08873
Copyright © 2023 LifeTein.com. Powered by LifeTein